Stem-loop sequence zma-MIR171i

AccessionMI0001838 (change log)
DescriptionZea mays miR171i stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention zma-MIR171i
(50 sentences)

Stem-loop
   cugguu    -     -ag  c                      ---a   -  g 
5'       ggcu gagag   ug gauguuggcacgguucaaucaa    ucg cc g
         |||| |||||   || ||||||||||||||||||||||    ||| || c
3'       ccga cucuu   ac cuauaaccgugccgaguuaguu    agu gg c
   ---gau    u     cca  a                      guuc   u  g 
Get sequence
Deep sequencing
5390 reads, 3.06e+03 reads per million, 196 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 278093492-278093595 [+]
intergenic
Database links

Mature sequence zma-miR171i-5p

Accession MIMAT0015201
Previous IDszma-miR171i*
Sequence

23 - 

uguuggcacgguucaaucaaa

 - 43

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR171i-3p

Accession MIMAT0001740
Previous IDszma-miR171i
Sequence

65 - 

ugauugagccgugccaauauc

 - 85

Get sequence
Deep sequencing2602 reads, 181 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).