Stem-loop sequence zma-MIR171e

AccessionMI0001837 (change log)
DescriptionZea mays miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention zma-MIR171e
(58 sentences)

Stem-loop
   agaa      u    g   u         u       c     c   -   c   c   -  auc 
5'     auggaa agua cua gauguuggc cggcuca ucaga gac gua gcg gcg ag   a
       |||||| |||| ||| ||||||||| ||||||| ||||| ||| ||| ||| ||| ||    
3'     uaccuu ucau gau cuauaaccg gccgagu agucu uug cgu cgc cgu uc   u
   uacg      c    -   u         u       u     -   u   -   -   a  gug 
Get sequence
Deep sequencing
2887 reads, 1.09e+03 reads per million, 183 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 7976712-7976837 [+]
intergenic
Database links

Mature sequence zma-miR171e-5p

Accession MIMAT0015200
Previous IDszma-miR171e*
Sequence

23 - 

uguuggcucggcucacucaga

 - 43

Get sequence
Deep sequencing615 reads, 147 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR171e-3p

Accession MIMAT0001739
Previous IDszma-miR171e
Sequence

87 - 

ugauugagccgugccaauauc

 - 107

Get sequence
Deep sequencing2247 reads, 173 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).