Stem-loop sequence zma-MIR171j

AccessionMI0001836 (change log)
DescriptionZea mays miR171j stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

20 open access papers mention zma-MIR171j
(85 sentences)

Stem-loop
   -aau  cc     cua    g       a            c      uc        g agagg  a 
5'     gg  gcgag   gacg gguauug cgcgguucaauu gagagc  gagcccua c     cc g
       ||  |||||   |||| ||||||| |||||||||||| ||||||  |||||||| |     ||  
3'     cc  cgcuc   cugc cuauaac gugccgaguuag cucucg  cucggggu g     gg g
   cgcu  --     acc    a       c            u      -u        g -----  g 
Get sequence
Deep sequencing
4034 reads, 2.13e+03 reads per million, 190 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 59006552-59006680 [+]
intergenic
Database links

Mature sequence zma-miR171j-5p

Accession MIMAT0015199
Previous IDszma-miR171j*
Sequence

23 - 

uauugacgcgguucaauucga

 - 43

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR171j-3p

Accession MIMAT0001738
Previous IDszma-miR171j
Sequence

90 - 

ugauugagccgugccaauauc

 - 110

Get sequence
Deep sequencing2219 reads, 165 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).