Stem-loop sequence zma-MIR171c

AccessionMI0001835 (change log)
DescriptionZea mays miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention zma-MIR171c
(51 sentences)

Stem-loop
   ggggaaucgaaaaccuacgg        ug       a     a  cuu c     aaa 
5'                     gauauugg  cgguuca ucaga ag   g gcucc   g
                       ||||||||  ||||||| ||||| ||   | |||||    
3'                     cuauaacc  gccgagu aguuu uc   c cgggg   c
   -cguucguuucgcuccugca        gu       c     c  -ac u     acc 
Get sequence
Deep sequencing
2253 reads, 793 reads per million, 153 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 9079646-9079763 [+]
intergenic
Database links

Mature sequence zma-miR171c-5p

Accession MIMAT0015198
Previous IDszma-miR171c*
Sequence

23 - 

uauuggugcgguucaaucaga

 - 43

Get sequence
Deep sequencing19 reads, 11 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR171c-3p

Accession MIMAT0001737
Previous IDszma-miR171c
Sequence

79 - 

ugacugagccgugccaauauc

 - 99

Get sequence
Deep sequencing2006 reads, 149 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).