Stem-loop sequence zma-MIR169e

AccessionMI0001834 (change log)
DescriptionZea mays miR169e stem-loop
Gene family MIPF0000323; MIR169_4
Literature search

30 open access papers mention zma-MIR169e
(222 sentences)

Stem-loop
   gc          --a   a  c          -    -     cgaaccaacacaaagguccacaa 
5'   aauaggggcc   cuc gg uagccaagga gacu gccua                       u
     ||||||||||   ||| || |||||||||| |||| |||||                       u
3'   uuauucccgg   gag cu aucgguuccu cuga cggau                       c
   --          acg   a  -          a    a     acaggaaacaaauguuuccuagu 
Get sequence
Deep sequencing
183 reads, 263 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 49625356-49625483 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR169e
zma-MIR169echr4: 49625356-49625483 [-]
zma-MIR169hchr4: 49625355-49625482 [+]
Database links

Mature sequence zma-miR169e

Accession MIMAT0001736
Sequence

21 - 

uagccaaggagacugccuacg

 - 41

Get sequence
Deep sequencing12 reads, 7 experiments
Evidence by similarity; MI0001132

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).