Stem-loop sequence zma-MIR169d

AccessionMI0001833 (change log)
DescriptionZea mays miR169d stem-loop
Gene family MIPF0000323; MIR169_4
Literature search

31 open access papers mention zma-MIR169d
(227 sentences)

Stem-loop
   gc          --a   a  c          -    -       aaccucucaaugguccacaca 
5'   aauaggggcc   cuc gg uagccaagga gacu gccuaug                     u
     ||||||||||   ||| || |||||||||| |||| |||||||                     u
3'   uuauucccgg   gag cu aucgguuccu cuga cggauac                     c
   --          aug   a  -          a    a       aggaaacaaauguuuccugga 
Get sequence
Deep sequencing
188 reads, 296 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 49565639-49565766 [-]
intergenic
Database links

Mature sequence zma-miR169d

Accession MIMAT0001735
Sequence

21 - 

uagccaaggagacugccuaug

 - 41

Get sequence
Deep sequencing13 reads, 7 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).