Stem-loop sequence zma-MIR169j

AccessionMI0001832 (change log)
DescriptionZea mays miR169j stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

31 open access papers mention zma-MIR169j
(216 sentences)

Stem-loop
   gcg     -a        a   -         u    u        cu  uu    ug  uu   uc      aaccu  u 
5'    auaag  gucugucc gau agccaagga gacu gccugugg  uc  ggcu  gc  ggc  gggcaa     ug g
      |||||  |||||||| ||| ||||||||| |||| ||||||||  ||  ||||  ||  |||  ||||||     ||  
3'    uauuc  cgggcggg cug ucgguuccu cuga cggacacu  ag  ccgg  ug  ccg  cucguu     gc c
   ---     cc        c   a         -    -        --  cu    --  cu   --      auuuu  a 
Get sequence
Deep sequencing
8787 reads, 6.05e+03 reads per million, 210 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 198435908-198436058 [+]
intergenic
Database links

Mature sequence zma-miR169j-5p

Accession MIMAT0001734
Previous IDszma-miR169j
Sequence

21 - 

uagccaaggaugacuugccug

 - 41

Get sequence
Deep sequencing1117 reads, 139 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR169j-3p

Accession MIMAT0015197
Previous IDszma-miR169j*
Sequence

116 - 

ggcagucuccuuggcuag

 - 133

Get sequence
Deep sequencing586 reads, 129 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).