Stem-loop sequence zma-MIR169k

AccessionMI0001831 (change log)
DescriptionZea mays miR169k stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

31 open access papers mention zma-MIR169k
(216 sentences)

Stem-loop
   -c         acu    u   -         u    u       gc uc  -   guc        cg 
5'   gaugagagc   gcuc ggu agccaagga gacu gccugug  c  ca uca   gcagagga  c
     |||||||||   |||| ||| ||||||||| |||| |||||||  |  || |||   ||||||||   
3'   cuacucucg   cgag ccg ucgguuccu cuga cggacgc  g  gu ggu   cgucuucu  u
   ac         --g    c   a         -    -       ua cu  u   guu        ug 
Get sequence
Deep sequencing
5798 reads, 4.22e+03 reads per million, 207 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 142286603-142286735 [+]
intergenic
Database links

Mature sequence zma-miR169k-5p

Accession MIMAT0001733
Previous IDszma-miR169k
Sequence

21 - 

uagccaaggaugacuugccug

 - 41

Get sequence
Deep sequencing2725 reads, 178 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR169k-3p

Accession MIMAT0015196
Previous IDszma-miR169k*
Sequence

97 - 

ggcagucuccuuggcuag

 - 114

Get sequence
Deep sequencing2068 reads, 190 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).