Stem-loop sequence zma-MIR169i

AccessionMI0001830 (change log)
DescriptionZea mays miR169i stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

31 open access papers mention zma-MIR169i
(238 sentences)

Stem-loop
   - a        gu  c  -u   -         u    u       u cu     -  cu c     u  -aa gac    -  gu     c   -  ag g 
5'  g ugagagug  ag uc  ggu agccaagga gacu gccugug g  ggcca cg  c ccuca gc   g   cauc uc  gucga cga cg  c a
    | ||||||||  || ||  ||| ||||||||| |||| ||||||| |  ||||| ||  | ||||| ||   |   |||| ||  ||||| ||| ||  |  
3'  c auucucac  uc ag  ccg ucgguuccu cuga cgggcac c  cuggu gc  g ggggu cg   c   guag ag  uagcu gcu gc  g g
   g c        --  -  uc   a         -    -       u -u     u  au u     u  aag --a    g  ag     a   a  ga c 
Get sequence
Deep sequencing
5313 reads, 3.97e+03 reads per million, 211 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 49299338-49299528 [+]
intergenic
Database links

Mature sequence zma-miR169i-5p

Accession MIMAT0001732
Previous IDszma-miR169i
Sequence

21 - 

uagccaaggaugacuugccug

 - 41

Get sequence
Deep sequencing2686 reads, 178 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR169i-3p

Accession MIMAT0015195
Previous IDszma-miR169i*
Sequence

155 - 

ggcagucuccuuggcuag

 - 172

Get sequence
Deep sequencing2033 reads, 194 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).