Stem-loop sequence zma-MIR169h

AccessionMI0001829 (change log)
DescriptionZea mays miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

31 open access papers mention zma-MIR169h
(217 sentences)

Stem-loop
        a     ugc   -uga          u    u       uc  uuguu        a   ga 
5' caaua gggcc   cuc    uagccaagga gacu gccuaug  cu     uacaaagg uca  a
   ||||| |||||   |||    |||||||||| |||| |||||||  ||     |||||||| |||   
3' guuau cccgg   gag    aucgguuccu cuga cggaugc  gg     guguuucc ggu  u
        c     --u   uccg          -    -       uu  ---uu        a   gu 
Get sequence
Deep sequencing
14684 reads, 1.16e+04 reads per million, 214 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 49625355-49625482 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR169h
zma-MIR169hchr4: 49625355-49625482 [+]
zma-MIR169echr4: 49625356-49625483 [-]
Database links

Mature sequence zma-miR169h

Accession MIMAT0001731
Sequence

21 - 

uagccaaggaugacuugccua

 - 41

Get sequence
Deep sequencing1509 reads, 136 experiments
Evidence by similarity; MI0001122

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).