Stem-loop sequence zma-MIR169g

AccessionMI0001828 (change log)
DescriptionZea mays miR169g stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

30 open access papers mention zma-MIR169g
(216 sentences)

Stem-loop
      a  --u    ugc   u   -         u    u       uggu    c   uu c   --u  u   u 
5' cag gc   agcc   cuc ggu agccaagga gacu gccuaca    cucg uag  c ggu   gu gca g
   ||| ||   ||||   ||| ||| ||||||||| |||| |||||||    |||| |||  | |||   || |||  
3' guc cg   ucgg   gag ccg ucgguuccu cugg cgggugu    gggu guc  g ccg   ca cgu c
      -  uuc    --u   u   a         -    -       --uu    c   cu a   uau  c   a 
Get sequence
Deep sequencing
3526 reads, 2.46e+03 reads per million, 194 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 67281149-67281288 [+]
intergenic
Database links

Mature sequence zma-miR169g

Accession MIMAT0001730
Sequence

21 - 

uagccaaggaugacuugccua

 - 41

Get sequence
Deep sequencing2087 reads, 172 experiments
Evidence by similarity; MI0001122

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).