Stem-loop sequence zma-MIR169f

AccessionMI0001827 (change log)
DescriptionZea mays miR169f stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

31 open access papers mention zma-MIR169f
(216 sentences)

Stem-loop
   --  c       a    uuc            u   u      g -         augggcuauggcuacaugccug 
5'   ac agagcug uucg   aguagccaagga gac ugccua g uauauaugc                      a
     || ||||||| ||||   |||||||||||| ||| |||||| | |||||||||                       
3'   ug ucucggc aggc   ucaucgguuccu cug acggau u auauguacg                      g
   ac  a       g    ---            u   u      g g         agucgcaguguucucugaccga 
Get sequence
Deep sequencing
2424 reads, 1.48e+03 reads per million, 170 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 168617435-168617584 [+]
intergenic
Database links

Mature sequence zma-miR169f-5p

Accession MIMAT0001729
Previous IDszma-miR169f
Sequence

21 - 

uagccaaggaugacuugccua

 - 41

Get sequence
Deep sequencing1452 reads, 126 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR169f-3p

Accession MIMAT0015194
Previous IDszma-miR169f*
Sequence

113 - 

ggcaugucuuccuuggcuacu

 - 133

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).