Stem-loop sequence zma-MIR169c

AccessionMI0001826 (change log)
DescriptionZea mays miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

31 open access papers mention zma-MIR169c
(228 sentences)

Stem-loop
   au    u       -   a  c          -         gcuccuggaaccuggaggcgucucag 
5'   gagg agagaac ggg ug agccaaggau gacuugccg                          c
     |||| ||||||| ||| || |||||||||| |||||||||                           
3'   cucc ucucuug ucc ac ucgguuccug cugaacggc                          u
   -u    u       a   -  a          u         ugauucaagauucggugucgugucgu 
Get sequence
Deep sequencing
4430 reads, 3.31e+03 reads per million, 211 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 11553338-11553471 [+]
intergenic
Database links

Mature sequence zma-miR169c-5p

Accession MIMAT0001728
Previous IDszma-miR169c
Sequence

21 - 

cagccaaggaugacuugccgg

 - 41

Get sequence
Deep sequencing1669 reads, 189 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR169c-3p

Accession MIMAT0015193
Previous IDszma-miR169c*
Sequence

96 - 

ggcaagucuguccuuggcuaca

 - 117

Get sequence
Deep sequencing1985 reads, 199 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).