Stem-loop sequence zma-MIR168b

AccessionMI0001825 (change log)
DescriptionZea mays miR168b stem-loop
Gene family MIPF0000081; MIR168
Literature search

30 open access papers mention zma-MIR168b
(137 sentences)

Stem-loop
   uc   c      u   g gc             au     c   ccg    g 
5'   cgc gcgccg cuc g  ucgcuuggugcag  cggga ccg   cccg c
     ||| |||||| ||| |  |||||||||||||  ||||| |||   |||| c
3'   gcg cgcggc gag c  agugaacuacguu  gcccu ggc   gggc g
   -a   a      c   g ua             cc     a   --a    a 
Get sequence
Deep sequencing
74358 reads, 9.48e+03 reads per million, 204 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 244520636-244520739 [-]
intergenic
Database links

Mature sequence zma-miR168b-5p

Accession MIMAT0001727
Previous IDszma-miR168b
Sequence

21 - 

ucgcuuggugcagaucgggac

 - 41

Get sequence
Deep sequencing68853 reads, 178 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR168b-3p

Accession MIMAT0015192
Previous IDszma-miR168b*
Sequence

67 - 

cccgccuugcaucaagugaa

 - 86

Get sequence
Deep sequencing1148 reads, 42 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).