Stem-loop sequence zma-MIR168a

AccessionMI0001824 (change log)
DescriptionZea mays miR168a stem-loop
Gene family MIPF0000081; MIR168
Literature search

34 open access papers mention zma-MIR168a
(156 sentences)

Stem-loop
   gaa  cg     c   g gc             au     c   ccg    g 
5'    gc  cgccg cuc g  ucgcuuggugcag  cggga ccg   cccg c
      ||  ||||| ||| |  |||||||||||||  ||||| |||   |||| c
3'    cg  gcggc gag c  agugaaccacguu  gcccu ggc   gggc g
   -ag  ag     c   g ua             cc     a   --a    a 
Get sequence
Deep sequencing
80986 reads, 1.43e+04 reads per million, 215 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 76534928-76535031 [-]
intergenic
Database links

Mature sequence zma-miR168a-5p

Accession MIMAT0001726
Previous IDszma-miR168a
Sequence

21 - 

ucgcuuggugcagaucgggac

 - 41

Get sequence
Deep sequencing68852 reads, 178 experiments
Evidence experimental; Illumina [3]
Database links

Mature sequence zma-miR168a-3p

Accession MIMAT0015191
Previous IDszma-miR168a*
Sequence

67 - 

cccgccuugcaccaagugaa

 - 86

Get sequence
Deep sequencing1746 reads, 145 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).