Stem-loop sequence zma-MIR167i

AccessionMI0001823 (change log)
DescriptionZea mays miR167i stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

30 open access papers mention zma-MIR167i
(125 sentences)

Stem-loop
   acu        -       cu         c            curcucaaa        gc uccca 
5'    ucgcuggu gugagag  ugaagcugc agcaugaucugg         cgccgccg  c     a
      |||||||| |||||||  ||||||||| ||||||||||||         ||||||||  |      
3'    agcgacca cgcucuc  acuucgacg uuguacuagacc         gcgguggc  g     g
   --a        a       uc         -            ----acuuc        ua cucgu 
Get sequence
Deep sequencing
31094 reads, 4.54e+03 reads per million, 205 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 113476123-113476252 [+]
intergenic
Database links

Mature sequence zma-miR167i-5p

Accession MIMAT0001725
Previous IDszma-miR167i
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Deep sequencing27256 reads, 203 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR167i-3p

Accession MIMAT0015190
Previous IDszma-miR167i*
Sequence

94 - 

gaucauguugcagcuucac

 - 112

Get sequence
Deep sequencing3057 reads, 134 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).