Stem-loop sequence zma-MIR167h

AccessionMI0001822 (change log)
DescriptionZea mays miR167h stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

29 open access papers mention zma-MIR167h
(124 sentences)

Stem-loop
   acu      -         gu         c            c  cucagacgccggcgggcgucucgagug 
5'    uugcug cugugagag  ugaagcugc agcaugaucugg ug                           c
      |||||| |||||||||  ||||||||| |||||||||||| ||                            
3'    aacgac gacgcucuc  acuucgacg uuguacuagacc ac                           u
   --a      c         uc         -            -  uuagguucgcaguggcugcuagcucgc 
Get sequence
Deep sequencing
35005 reads, 7.1e+03 reads per million, 213 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 95985872-95986014 [-]
intergenic
Database links

Mature sequence zma-miR167h-5p

Accession MIMAT0001724
Previous IDszma-miR167h
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Deep sequencing25834 reads, 189 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR167h-3p

Accession MIMAT0015189
Previous IDszma-miR167h*
Sequence

107 - 

gaucauguugcagcuucac

 - 125

Get sequence
Deep sequencing3057 reads, 134 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).