Stem-loop sequence zma-MIR167g

AccessionMI0001821 (change log)
DescriptionZea mays miR167g stem-loop
Gene family MIPF0000125; MIR167_2
Literature search

29 open access papers mention zma-MIR167g
(127 sentences)

Stem-loop
   agug    -a    g   u           c              a  augguggugguauauguaagauggauguaaucuauacuacuaccggccccugucacucucucucucucccccgu 
5'     gugc  ccac agu ggugaagcugc agcaugaucugguu ug                                                                          c
       ||||  |||| ||| ||||||||||| |||||||||||||| ||                                                                          c
3'     cacg  ggug ucg cuacuuugaug ucguacuggaccag ac                                                                          c
   --ua    cc    g   u           -              g  cacgaguaauuaaugggagagagagagagggaaggggagaguagaaccuaagcagcuagguauauacugucagu 
Get sequence
Deep sequencing
26953 reads, 3.27e+03 reads per million, 208 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 119394584-119394826 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR167g
zma-MIR167achr3: 119392621-119392810 [+]
zma-MIR167gchr3: 119394584-119394826 [+]
Database links

Mature sequence zma-miR167g-5p

Accession MIMAT0001723
Previous IDszma-miR167g
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Deep sequencing26168 reads, 204 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR167g-3p

Accession MIMAT0015188
Previous IDszma-miR167g*
Sequence

207 - 

ggucaugcuguaguuucauc

 - 226

Get sequence
Deep sequencing25 reads, 18 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).