Stem-loop sequence zma-MIR167f

AccessionMI0001820 (change log)
DescriptionZea mays miR167f stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

30 open access papers mention zma-MIR167f
(125 sentences)

Stem-loop
   -c    a  uu    a    c         -            -     --uc     cu g 
5'   gugc cc  auua gcag ugaagcugc cagcaugaucug aucuu    guuua  g c
     |||| ||  |||| |||| ||||||||| |||||||||||| |||||    |||||  |  
3'   cacg gg  uaau cguc acuuugacg gucgugcuagac uagaa    uaggu  c a
   ga    a  -u    -    c         c            c     ucca     uu a 
Get sequence
Deep sequencing
25496 reads, 2.63e+03 reads per million, 193 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 195044719-195044837 [+]
intergenic
Database links

Mature sequence zma-miR167f-5p

Accession MIMAT0001722
Previous IDszma-miR167f
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Deep sequencing25371 reads, 192 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR167f-3p

Accession MIMAT0015187
Previous IDszma-miR167f*
Sequence

81 - 

gaucgugcugcgcaguuucacc

 - 102

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).