Stem-loop sequence zma-MIR167e

AccessionMI0001819 (change log)
DescriptionZea mays miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

31 open access papers mention zma-MIR167e
(131 sentences)

Stem-loop
   uug        u u     c         -             gguguccacagcauau 
5'    gugugucc c aguag ugaagcugc cagcaugaucuga                a
      |||||||| | ||||| ||||||||| |||||||||||||                u
3'    cacgcagg g ucguc acuuugacg gucguacuagacu                a
   -ca        u c     u         u             agcgaucgacgaaggu 
Get sequence
Deep sequencing
25710 reads, 2.53e+03 reads per million, 197 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 10115799-10115917 [-]
intergenic
Database links

Mature sequence zma-miR167e-5p

Accession MIMAT0001721
Previous IDszma-miR167e
Sequence

21 - 

ugaagcugccagcaugaucug

 - 41

Get sequence
Deep sequencing25501 reads, 192 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR167e-3p

Accession MIMAT0015186
Previous IDszma-miR167e*
Sequence

81 - 

gaucaugcugugcaguuucauc

 - 102

Get sequence
Deep sequencing60 reads, 21 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).