Stem-loop sequence zma-MIR166j

AccessionMI0001818 (change log)
DescriptionZea mays miR166j stem-loop
Gene family MIPF0000004; MIR166
Literature search

32 open access papers mention zma-MIR166j
(188 sentences)

Stem-loop
   caagu  a    -ua          u   uuu         a         caca     gaaa       ---uc  cuug 
5'      ug agau   gguuaagggg uug   gucugguuc aggucgcca    gcagg    acccauu     gc    a
        || ||||   |||||||||| |||   ||||||||| |||||||||    |||||    |||||||     ||     
3'      ac ucug   ucaauuuccc aac   cggaccagg ucuaguggu    ugucc    uggguag     cg    a
   --uau  g    cga          u   -uu         c         ----     -aug       uacca  uacg 
Get sequence
Deep sequencing
141975 reads, 8.81e+03 reads per million, 191 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 128589394-128589547 [+]
intergenic
Database links

Mature sequence zma-miR166j-5p

Accession MIMAT0015185
Previous IDszma-miR166j*
Sequence

23 - 

gguuuguuugucugguucaagg

 - 44

Get sequence
Deep sequencing96 reads, 30 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR166j-3p

Accession MIMAT0001720
Previous IDszma-miR166j
Sequence

115 - 

ucggaccaggcuucaaucccu

 - 135

Get sequence
Deep sequencing140081 reads, 71 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).