Stem-loop sequence zma-MIR166k

AccessionMI0001817 (change log)
DescriptionZea mays miR166k stem-loop
Gene family MIPF0000004; MIR166
Literature search

33 open access papers mention zma-MIR166k
(191 sentences)

Stem-loop
   --gc    u  g  ua              uu      cu  gg            gau    ucauaacauau   u  gu     ua   u 
5'     augc cg gu  ggucagggggauug  gucugg  cg  gucuccggucga   cgau           acg ac  gcuuc  gcc u
       |||| || ||  ||||||||||||||  ||||||  ||  ||||||||||||   ||||           ||| ||  |||||  ||| g
3'     uacg gc ua  ccaguuucccuaac  cggacc  gc  uagaggccagcu   gcug           ugc ug  cgagg  cgg c
   ggau    -  g  --              uu      ag  uu            ---    ----------u   -  au     --   c 
Get sequence
Deep sequencing
152706 reads, 1.04e+04 reads per million, 197 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 216483766-216483933 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR166k
zma-MIR166mchr5: 216484037-216484192 [-]
zma-MIR166kchr5: 216483766-216483933 [-]
Database links

Mature sequence zma-miR166k-5p

Accession MIMAT0015184
Previous IDszma-miR166k*
Sequence

23 - 

ggauuguugucuggcucgggg

 - 43

Get sequence
Deep sequencing1505 reads, 140 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR166k-3p

Accession MIMAT0001719
Previous IDszma-miR166k
Sequence

129 - 

ucggaccaggcuucaaucccu

 - 149

Get sequence
Deep sequencing148313 reads, 163 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).