Stem-loop sequence zma-MIR319d

AccessionMI0001816 (change log)
DescriptionZea mays miR319d stem-loop
Gene family MIPF0000010; MIR159
Literature search

19 open access papers mention zma-MIR319d
(64 sentences)

Stem-loop
   uggucgccggcc    -   a a    gu           cu            ua        ----   g  g   ac        c  ca   c    aaa  --g c 
5'             ggau gga g gagc  ccuucagucca  caggggcggugc  gggucgga    uua cu ccg  ucauucac ca  ugc aagc   cg   c a
               |||| ||| | ||||  |||||||||||  ||||||||||||  ||||||||    ||| || |||  |||||||| ||  ||| ||||   ||   |  
3'             ccua ccu c cucg  ggaagucaggu  guuucugccacg  ucuagcuu    aau ga ggc  aguaagug gu  acg uucg   gc   g u
   -uuuguuccuuu    g   c -    ug           uc            -c        cgaa   g  g   ga        a  ag   c    --a  aaa g 
Get sequence
Deep sequencing
9106 reads, 5.9e+03 reads per million, 216 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 27608247-27608458 [-]
intergenic
Database links

Mature sequence zma-miR319d-5p

Accession MIMAT0015183
Previous IDszma-miR319d*
Sequence

22 - 

agagcguccuucaguccacuc

 - 42

Get sequence
Deep sequencing255 reads, 122 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR319d-3p

Accession MIMAT0001718
Previous IDszma-miR319d
Sequence

174 - 

uuggacugaagggugcuccc

 - 193

Get sequence
Deep sequencing4283 reads, 206 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).