Stem-loop sequence zma-MIR319b

AccessionMI0001815 (change log)
DescriptionZea mays miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

21 open access papers mention zma-MIR319b
(76 sentences)

Stem-loop
   gac     u -  -u  au   a a    gu           cu            ua        ----   g  g   ac        c  ca   c    aaacgg c 
5'    gacga g gc  gg  gga g gagc  ccuucagucca  caggggcggugc  gggucgaa    uua cu ccg  ucauucac ca  ugc aagc      c a
      ||||| | ||  ||  ||| | ||||  |||||||||||  ||||||||||||  ||||||||    ||| || |||  |||||||| ||  ||| ||||      |  
3'    uuguu c cg  cc  ccu c cucg  ggaagucaggu  guuucugccacg  ucuagcuu    aau ga ggc  aguaagug gu  acg uucg      g u
   ---     c u  cu  cu   c -    ug           uc            -c        cgaa   g  g   ga        a  ag   u    accaaa g 
Get sequence
Deep sequencing
11521 reads, 7.61e+03 reads per million, 213 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 2038966-2039178 [+]
intergenic
Database links

Mature sequence zma-miR319b-5p

Accession MIMAT0015182
Previous IDszma-miR319b*
Sequence

23 - 

agagcguccuucaguccacuc

 - 43

Get sequence
Deep sequencing255 reads, 122 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR319b-3p

Accession MIMAT0001717
Previous IDszma-miR319b
Sequence

175 - 

uuggacugaagggugcuccc

 - 194

Get sequence
Deep sequencing3895 reads, 204 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).