Stem-loop sequence zma-MIR319c

AccessionMI0001814 (change log)
DescriptionZea mays miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

20 open access papers mention zma-MIR319c
(68 sentences)

Stem-loop
   --g    au   uucugug    a    u            cu ua       u         --ca      g   ac          ac         a   u  g aag 
5'    guuu  ggc       gaag gagc cucuucagucca  c  aaauggc guaggguuu    uuagcu ccg  ucauccauuc  cugccaaga cca gg c   c
      ||||  |||       |||| |||| ||||||||||||  |  ||||||| |||||||||    |||||| |||  ||||||||||  ||||||||| ||| || |    
3'    caaa  ccg       cuuc cucg gggaagucaggu  g  uuugucg caucucaaa    aaucga ggc  ggugggugag  gaugguucu ggu cu g   g
   uca    -c   --uuuaa    c    u            ug ca       -         cuaa      g   gc          cc         -   -  g aug 
Get sequence
Deep sequencing
6645 reads, 4.68e+03 reads per million, 209 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 152709450-152709665 [-]
intergenic
Database links

Mature sequence zma-miR319c-5p

Accession MIMAT0015181
Previous IDszma-miR319c*
Sequence

23 - 

gagcucucuucaguccacuc

 - 42

Get sequence
Deep sequencing180 reads, 127 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR319c-3p

Accession MIMAT0001716
Previous IDszma-miR319c
Sequence

178 - 

uuggacugaagggugcuccc

 - 197

Get sequence
Deep sequencing4913 reads, 209 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).