Stem-loop sequence zma-MIR319a

AccessionMI0001813 (change log)
DescriptionZea mays miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

22 open access papers mention zma-MIR319a
(73 sentences)

Stem-loop
   gguucauguuuucucu     a    u            cu ug       u         --ca      g   ac          ac         a   ug  c 
5'                 ggaag gagc cucuucagucca  c  aaauggc guaggguuu    uuagcu ccg  ucauccauuc  cugccaaga cca  ga a
                   ||||| |||| ||||||||||||  |  ||||||| |||||||||    |||||| |||  ||||||||||  ||||||||| |||  ||  
3'                 uuuuc cucg gggaagucaggu  g  uuugucg caucucgaa    aaucga ggc  ggugggugag  gaugguucu ggu  cu g
   -ucgcaaacucguuug     c    u            ug ug       -         cuaa      g   gc          cc         -   --  g 
Get sequence
Deep sequencing
5861 reads, 3.99e+03 reads per million, 212 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 215788718-215788926 [+]
intergenic
Database links

Mature sequence zma-miR319a-5p

Accession MIMAT0015180
Previous IDszma-miR319a*
Sequence

23 - 

gagcucucuucaguccacuc

 - 42

Get sequence
Deep sequencing168 reads, 125 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR319a-3p

Accession MIMAT0001715
Previous IDszma-miR319a
Sequence

171 - 

uuggacugaagggugcuccc

 - 190

Get sequence
Deep sequencing4519 reads, 211 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).