Stem-loop sequence zma-MIR159d

AccessionMI0001812 (change log)
DescriptionZea mays miR159d stem-loop
Gene family MIPF0000010; MIR159
Literature search

32 open access papers mention zma-MIR159d
(156 sentences)

Stem-loop
   --    -   ugcc  uc  uc  a                  uc  g         ----       cug ag  g    u     g      -cucu       caau   cg 
5'   aaga aga    ga  ga  ga gagcucccuucgauccaa  ca gagggaaag    uggucgg   c  cu ccgg ucaug auaccu     ggugcag    ggc  a
     |||| |||    ||  ||  || ||||||||||||||||||  || |||||||||    |||||||   |  || |||| ||||| ||||||     |||||||    |||   
3'   uucu ucu    cu  cu  cu cucgagggaaguuagguu  gu cucccuuuc    accagcc   g  ga ggcc aguac uguggg     ucacguc    ucg  g
   ua    c   ----  cu  cu  c                  -c  g         uacu       -aa ca  g    c     g      uacgu       -cac   ua 
Get sequence
Deep sequencing
12039 reads, 6.15e+03 reads per million, 208 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 27675686-27675902 [+]
intergenic
Database links

Mature sequence zma-miR159d-5p

Accession MIMAT0015179
Previous IDszma-miR159d*
Sequence

23 - 

gagcucccuucgauccaaucc

 - 43

Get sequence
Deep sequencing1183 reads, 175 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR159d-3p

Accession MIMAT0001714
Previous IDszma-miR159d
Sequence

178 - 

cuuggauugaagggagcuccu

 - 198

Get sequence
Deep sequencing8606 reads, 195 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).