Stem-loop sequence zma-MIR159c

AccessionMI0001811 (change log)
DescriptionZea mays miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

31 open access papers mention zma-MIR159c
(155 sentences)

Stem-loop
   --au   ua   a     auc  a                  uc  g         ----    c    g  g  g    u     g      -cucu       caa  -  c 
5'     gau  aga aggcg   ga gagcucccuucgauccaa  ca gaggggaag    uggu gguu ca cu ccgg ucaug auaccu     ggugcag   ug gc g
       |||  ||| |||||   || ||||||||||||||||||  || |||||||||    |||| |||| || || |||| ||||| ||||||     |||||||   || ||  
3'     cug  ucu ucugu   cu cucgagggaaguuagguu  gu cucccuuuc    accg ccga gu ga ggcc aguac uguggg     ucacguc   ac cg c
   cugu   --   g     -cu  c                  -c  g         uacu    c    -  a  g    c     g      uacgu       ucc  u  u 
Get sequence
Deep sequencing
12507 reads, 6.42e+03 reads per million, 212 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 2020760-2020976 [-]
intergenic
Database links

Mature sequence zma-miR159c-5p

Accession MIMAT0015178
Previous IDszma-miR159c*
Sequence

23 - 

gagcucccuucgauccaaucc

 - 43

Get sequence
Deep sequencing1183 reads, 175 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR159c-3p

Accession MIMAT0001713
Previous IDszma-miR159c
Sequence

178 - 

cuuggauugaagggagcuccu

 - 198

Get sequence
Deep sequencing8606 reads, 195 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).