Stem-loop sequence zma-MIR159b

AccessionMI0001810 (change log)
DescriptionZea mays miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

31 open access papers mention zma-MIR159b
(160 sentences)

Stem-loop
   uagac     -  uc     --    u           a    uaaa        cu  -u   ug  a     g    u     guuc    ugu         -u  gagaga 
5'      ggucu gg  uuaag  gcgg gcucccuucaa ccaa    cggucgau  ga  ggg  gu cagcu cucg ucaug    ccac   cccaucuca  ca      g
        ||||| ||  |||||  |||| ||||||||||| ||||    ||||||||  ||  |||  || ||||| |||| |||||    ||||   |||||||||  ||       
3'      ucaga cc  gguuc  cguc cgagggaaguu gguu    gccaguug  cu  ccc  ca gucga gagc aguac    ggug   ggguagagu  gu      a
   ----u     a  cu     ua    u           a    uguc        --  uc   ug  c     g    c     guuu    uuc         uc  agagag 
Get sequence
Deep sequencing
12396 reads, 5.27e+03 reads per million, 211 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 10950933-10951153 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR159b
zma-MIR159kchr8: 10947058-10947257 [+]
zma-MIR159bchr8: 10950933-10951153 [+]
Database links

Mature sequence zma-miR159b-5p

Accession MIMAT0015177
Previous IDszma-miR159b*
Sequence

23 - 

gugcucccuucaaaccaauaa

 - 43

Get sequence
Evidence experimental; Illumina [2]

Mature sequence zma-miR159b-3p

Accession MIMAT0001712
Previous IDszma-miR159b
Sequence

182 - 

uuuggauugaagggagcucug

 - 202

Get sequence
Deep sequencing11468 reads, 211 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).