Stem-loop sequence zma-MIR159a

AccessionMI0001809 (change log)
DescriptionZea mays miR159a stem-loop
Gene family MIPF0000010; MIR159
Literature search

32 open access papers mention zma-MIR159a
(247 sentences)

Stem-loop
   ucgaugcuu      -u  a           a   u     u  ag     uuc   -a    u   u c   g    u     guuc    uau         ucauguguauauauguaaucc 
5'          uggguu  ga gcggagcuccu uca uccaa ga  ggucg   cga  gggc ggu c gcu cucg ucaug    ccac   ccuaucuca                     a
            ||||||  || ||||||||||| ||| ||||| ||  |||||   |||  |||| ||| | ||| |||| |||||    ||||   |||||||||                     u
3'          accuag  cu cgucucgaggg agu agguu cu  ccggu   guu  cccg cca g cga gagc aguac    ggug   ggauagagu                     g
   --ccucccc      uc  a           a   u     u  cg     --c   cc    -   c u   g    c     guuu    uuc         uucugcucucuuugggagggg 
Get sequence
Deep sequencing
13984 reads, 5.97e+03 reads per million, 212 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr8: 10753073-10753318 [+]
intergenic
Database links

Mature sequence zma-miR159a-5p

Accession MIMAT0015176
Previous IDszma-miR159a*
Sequence

23 - 

gagcuccuaucauuccaauga

 - 43

Get sequence
Deep sequencing27 reads, 13 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR159a-3p

Accession MIMAT0001711
Previous IDszma-miR159a
Sequence

207 - 

uuuggauugaagggagcucug

 - 227

Get sequence
Deep sequencing12438 reads, 212 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).