Stem-loop sequence zma-MIR156j

AccessionMI0001808 (change log)
DescriptionZea mays miR156j stem-loop
Gene family MIPF0000008; MIR156
Literature search

52 open access papers mention zma-MIR156j
(340 sentences)

Stem-loop
   --  a    a   cg  a          -a    -          --a   -a   cc       a 
5'   cg gugg ccu  gg gcgaugacag  agag agagagcaca   ccc  gca  agcgagg a
     || |||| |||  || ||||||||||  |||| ||||||||||   |||  |||  ||||||| a
3'   gc cacc gga  cc cgcuacuguc  ucuc ucucucgugu   ggg  cgu  ucgcucc a
   aa  -    -   ca  -          ac    g          gcc   ag   cu       g 
Get sequence
Deep sequencing
137014 reads, 6.28e+03 reads per million, 202 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr7: 134663764-134663888 [-]
intergenic
Database links

Mature sequence zma-miR156j-5p

Accession MIMAT0001710
Previous IDszma-miR156j
Sequence

21 - 

ugacagaagagagagagcaca

 - 41

Get sequence
Deep sequencing136439 reads, 201 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR156j-3p

Accession MIMAT0015175
Previous IDszma-miR156j*
Sequence

86 - 

ugcucucugcucucacugucauc

 - 108

Get sequence
Deep sequencing235 reads, 113 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).