Stem-loop sequence zma-MIR399f

AccessionMI0001807 (change log)
DescriptionZea mays miR399f stem-loop
Gene family MIPF0000015; MIR399
Literature search

22 open access papers mention zma-MIR399f
(65 sentences)

Stem-loop
   cagga      cc  c     u      c  c           ---au    ga 
5'      ugugca  ug auuuc gggcaa uu uccuuuggcag     gcgc  g
        ||||||  || ||||| |||||| || |||||||||||     ||||   
3'      acacgu  ac uaagg cccguu aa aggaaaccguc     cgug  a
   -acga      cu  u     c      u  -           gucac    ua 
Get sequence
Deep sequencing
233 reads, 186 reads per million, 116 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 163860157-163860261 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR399f
zma-MIR399cchr6: 163867932-163868138 [+]
zma-MIR399fchr6: 163860157-163860261 [-]
Database links

Mature sequence zma-miR399f-5p

Accession MIMAT0015174
Previous IDszma-miR399f*
Sequence

23 - 

gggcaacuucuccuuuggcaga

 - 44

Get sequence
Deep sequencing34 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR399f-3p

Accession MIMAT0001709
Previous IDszma-miR399f
Sequence

66 - 

ugccaaaggaaauuugccccg

 - 86

Get sequence
Deep sequencing67 reads, 1 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).