Stem-loop sequence zma-MIR399e

AccessionMI0001806 (change log)
DescriptionZea mays miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

25 open access papers mention zma-MIR399e
(72 sentences)

Stem-loop
   augcc      --    a   u      uu     uc         ---------a    u    u  c 
5'      uaagcu  gucc guu cagggc  cucuu  uuggcaggg          agca gaga gc a
        ||||||  |||| ||| ||||||  |||||  |||||||||          |||| |||| ||  
3'      auucga  cagg caa gucccg  gagag  aaccgucuc          ucgu cucu cg u
   ---gu      cu    a   u      uu     ga         ccaacuucuc    -    -  a 
Get sequence
Deep sequencing
1092 reads, 486 reads per million, 125 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 16763309-16763432 [-]
intergenic
Database links

Mature sequence zma-miR399e-5p

Accession MIMAT0015173
Previous IDszma-miR399e*
Sequence

23 - 

gggcuucucuuucuuggcagg

 - 43

Get sequence
Deep sequencing270 reads, 113 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR399e-3p

Accession MIMAT0001708
Previous IDszma-miR399e
Sequence

85 - 

ugccaaaggagaguugcccug

 - 105

Get sequence
Deep sequencing689 reads, 6 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).