Stem-loop sequence zma-MIR399d

AccessionMI0001805 (change log)
DescriptionZea mays miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

22 open access papers mention zma-MIR399d
(67 sentences)

Stem-loop
   --u  a   --ga    ca   u ug        c      gaa    c  cu ag    ac   c 
5'    ca ggu    gaau  cag g  gcucuccu uggcau   ggcg gg  g  aggc  gaa a
      || |||    ||||  ||| |  |||||||| ||||||   |||| ||  |  ||||  |||  
3'    gu ccg    cuua  guc c  cgagagga accgua   ccgu cc  c  uccg  cuu g
   aac  c   auug    cc   c gu        a      --a    -  -- cu    gu   u 
Get sequence
Deep sequencing
6980 reads, 4.99e+03 reads per million, 200 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 192096065-192096189 [+]
intergenic
Database links

Mature sequence zma-miR399d-5p

Accession MIMAT0015172
Previous IDszma-miR399d*
Sequence

18 - 

guguggcucuccucuggcaug

 - 38

Get sequence
Deep sequencing318 reads, 1 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR399d-3p

Accession MIMAT0001707
Previous IDszma-miR399d
Sequence

86 - 

ugccaaaggagagcugcccug

 - 106

Get sequence
Deep sequencing644 reads, 114 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).