Stem-loop sequence zma-MIR399b

AccessionMI0001804 (change log)
DescriptionZea mays miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

23 open access papers mention zma-MIR399b
(69 sentences)

Stem-loop
   guagcu      --gc    ca   ug          c     u --       u    ga gc 
5'       cagggu    gaau  cag  cagcucuccu uggca g  aaggcug gaga  g  a
         ||||||    ||||  |||  |||||||||| ||||| |  ||||||| ||||  |   
3'       gucccg    cuua  guc  gucgagagga accgu c  uuccggu cuuu  c  u
   ---aac      auua    cc   cu          a     c cg       -    aa ag 
Get sequence
Deep sequencing
1165 reads, 431 reads per million, 123 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 158285681-158285802 [+]
intergenic
Database links

Mature sequence zma-miR399b-5p

Accession MIMAT0015171
Previous IDszma-miR399b*
Sequence

23 - 

gugcagcucuccucuggcaug

 - 43

Get sequence
Deep sequencing593 reads, 4 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR399b-3p

Accession MIMAT0001706
Previous IDszma-miR399b
Sequence

83 - 

ugccaaaggagagcuguccug

 - 103

Get sequence
Deep sequencing342 reads, 116 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).