Stem-loop sequence zma-MIR399c

AccessionMI0001803 (change log)
DescriptionZea mays miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

23 open access papers mention zma-MIR399c
(73 sentences)

Stem-loop
   ugc         -au    ua       cg             a   -ga    acacaucaucagucgagagaguaagcucgcugcgugcucgccggccuggga 
5'    uugcugagc   gaau  cagggua  ucuccuuuggcac gca   augc                                                   g
      |||||||||   ||||  |||||||  ||||||||||||| |||   ||||                                                    
3'    agcgacucg   cuua  gucccgu  agaggaaaccgug cgu   uaug                                                   c
   --u         gau    gc       ua             -   aua    ccgucgacgacaaguacguagacguggcggcgguaaaccggacgcugaagg 
Get sequence
Deep sequencing
5156 reads, 3.63e+03 reads per million, 184 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr6: 163867932-163868138 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR399c
zma-MIR399fchr6: 163860157-163860261 [-]
zma-MIR399cchr6: 163867932-163868138 [+]
Database links

Mature sequence zma-miR399c-5p

Accession MIMAT0015170
Previous IDszma-miR399c*
Sequence

23 - 

ggguacgucuccuuuggcaca

 - 43

Get sequence
Deep sequencing271 reads, 109 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR399c-3p

Accession MIMAT0001705
Previous IDszma-miR399c
Sequence

168 - 

ugccaaaggagaauugcccug

 - 188

Get sequence
Deep sequencing623 reads, 6 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).