Stem-loop sequence zma-MIR399a

AccessionMI0001802 (change log)
DescriptionZea mays miR399a stem-loop
Gene family MIPF0000015; MIR399
Literature search

23 open access papers mention zma-MIR399a
(67 sentences)

Stem-loop
   ugugaag     -ga    ca   u           c     -c     c   cca a    cu 
5'        agggu   gaau  cag gcgguucuccu uggca  gaagg ugg   g gcag  u
          |||||   ||||  ||| ||||||||||| |||||  ||||| |||   | ||||   
3'        uccca   cuua  guc cguuaagagga accgu  cuucc acc   c cguu  a
   --uaacg     aca    cc   c           a     uc     c   --a -    au 
Get sequence
Deep sequencing
675 reads, 642 reads per million, 24 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 233617206-233617328 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR399a
zma-MIR399gchr4: 233618406-233618473 [+]
zma-MIR399achr4: 233617206-233617328 [-]
Database links

Mature sequence zma-miR399a-5p

Accession MIMAT0015169
Previous IDszma-miR399a*
Sequence

23 - 

gugcgguucuccucuggcacg

 - 43

Get sequence
Deep sequencing20 reads, 4 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR399a-3p

Accession MIMAT0001704
Previous IDszma-miR399a
Sequence

84 - 

ugccaaaggagaauugcccug

 - 104

Get sequence
Deep sequencing627 reads, 10 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).