Stem-loop sequence zma-MIR396a

AccessionMI0001801 (change log)
DescriptionZea mays miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention zma-MIR396a
(93 sentences)

Stem-loop
   aca     -   c    c  c            c      ugcaugccgccggcugguggaugcugcgc 
5'    uggcc cuc uugc gu uuccacagcuuu uugaac                             g
      ||||| ||| |||| || |||||||||||| ||||||                              
3'    accgg gag gacg ca agggugucgaaa aacuug                             c
   --c     a   a    u  a            u      acgcggagaacccuagcuggccuuaaguu 
Get sequence
Deep sequencing
3350 reads, 2.06e+03 reads per million, 190 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 176326883-176327019 [+]
intergenic
Clustered miRNAs
< 10kb from zma-MIR396a
zma-MIR396achr4: 176326883-176327019 [+]
zma-MIR396echr4: 176331864-176332029 [-]
Database links

Mature sequence zma-miR396a-5p

Accession MIMAT0001703
Previous IDszma-miR396a
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Deep sequencing1647 reads, 146 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR396a-3p

Accession MIMAT0015168
Previous IDszma-miR396a*
Sequence

100 - 

guucaauaaagcugugggaaa

 - 120

Get sequence
Deep sequencing368 reads, 37 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).