Stem-loop sequence zma-MIR396b

AccessionMI0001800 (change log)
DescriptionZea mays miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

24 open access papers mention zma-MIR396b
(78 sentences)

Stem-loop
   aga      -       ga c            c           cucucagaggagcggcagcuuca 
5'    uggccu ucuuugu  u uuccacagcuuu uugaacugcau                       a
      |||||| |||||||  | |||||||||||| |||||||||||                       c
3'    accgga agagacg  a agggugucgaaa aacuugacgua                       u
   --g      g       uc a            u           cguggacgacuacgcccaccucc 
Get sequence
Deep sequencing
2598 reads, 1.56e+03 reads per million, 182 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 15122740-15122875 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR396b
zma-MIR396hchr9: 15122758-15122881 [+]
zma-MIR396bchr9: 15122740-15122875 [-]
Database links

Mature sequence zma-miR396b-5p

Accession MIMAT0001702
Previous IDszma-miR396b
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Deep sequencing1440 reads, 138 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR396b-3p

Accession MIMAT0015167
Previous IDszma-miR396b*
Sequence

99 - 

guucaauaaagcugugggaaa

 - 119

Get sequence
Deep sequencing316 reads, 38 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).