Stem-loop sequence zma-MIR395a

AccessionMI0001799 (change log)
DescriptionZea mays miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

19 open access papers mention zma-MIR395a
(92 sentences)

Stem-loop
   uauug        u    ug         u     c      g u       c     aguuuaa    acug      c 
5'      guugguug cacc  gaguucucc caaac acuuca u gcugcac uagcu       uggc    ugcuug g
        |||||||| ||||  ||||||||| ||||| |||||| | ||||||| |||||       ||||    ||||||  
3'      cgacuaac gugg  cucaagggg guuug ugaagu a cgaugug gucga       gccg    gcgaac u
   -uuaa        u    gu         -     -      g u       u     ------g    ----      g 
Get sequence
Deep sequencing
1287 reads, 1.33e+03 reads per million, 168 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 6288043-6288191 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395a
zma-MIR395achr2: 6288043-6288191 [-]
zma-MIR395bchr2: 6287388-6287501 [-]
zma-MIR395hchr2: 6287229-6287313 [-]
zma-MIR395ichr2: 6286588-6286657 [-]
zma-MIR395echr2: 6286411-6286495 [-]
Database links

Mature sequence zma-miR395a-5p

Accession MIMAT0015166
Previous IDszma-miR395a*
Sequence

23 - 

guucuccucaaaccacuucaguu

 - 45

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR395a-3p

Accession MIMAT0001701
Previous IDszma-miR395a
Sequence

110 - 

gugaaguguuugggggaacuc

 - 130

Get sequence
Deep sequencing362 reads, 148 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).