Stem-loop sequence zma-MIR395c

AccessionMI0001798 (change log)
Previous IDszma-MIR395d
DescriptionZea mays miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

18 open access papers mention zma-MIR395c
(85 sentences)

Stem-loop
   ucuug     uucu c           c g            - -       ------------c   a    cgg 
5'      guugg    c cuuggaguucc u caaacacuucac c agcuagg             cau gugc   c
        |||||    | ||||||||||| | |||||||||||| | |||||||             ||| ||||    
3'      cgacc    g ggaucucaagg a guuugugaagug g ucgaucc             gua cacg   c
   -guaa     uauu u           - g            u a       acuagucuauguu   a    uuc 
Get sequence
Deep sequencing
11845 reads, 8.71e+03 reads per million, 205 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 78600687-78600824 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395c
zma-MIR395cchr10: 78600687-78600824 [-]
zma-MIR395mchr10: 78600541-78600622 [-]
zma-MIR395lchr10: 78600412-78600492 [-]
zma-MIR395kchr10: 78600241-78600324 [-]
Database links

Mature sequence zma-miR395c-5p

Accession MIMAT0015165
Previous IDszma-miR395c*
Sequence

23 - 

guucccugcaaacacuucacca

 - 44

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence by similarity; MI0001035

Mature sequence zma-miR395c-3p

Accession MIMAT0001700
Previous IDszma-miR395d;zma-miR395c
Sequence

99 - 

gugaaguguuuggaggaacuc

 - 119

Get sequence
Deep sequencing363 reads, 120 experiments
Evidence by similarity; MI0001035

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).