Stem-loop sequence zma-MIR395b

AccessionMI0001796 (change log)
DescriptionZea mays miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

19 open access papers mention zma-MIR395b
(88 sentences)

Stem-loop
   gcaac    ug  u               a               accu     caaua 
5'      guuu  ug uacuaggaguucccu caagcacuucacaau    uggcu     a
        ||||  || ||||||||||||||| |||||||||||||||    |||||      
3'      cgaa  ac augguucucaagggg guuugugaaguguug    accgg     a
   -uuua    gu  u               -               ----     aaauu 
Get sequence
Deep sequencing
204 reads, 1.02e+03 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 6287388-6287501 [-]
intergenic
Clustered miRNAs
< 10kb from zma-MIR395b
zma-MIR395achr2: 6288043-6288191 [-]
zma-MIR395bchr2: 6287388-6287501 [-]
zma-MIR395hchr2: 6287229-6287313 [-]
zma-MIR395ichr2: 6286588-6286657 [-]
zma-MIR395echr2: 6286411-6286495 [-]
Database links

Mature sequence zma-miR395b-5p

Accession MIMAT0015164
Previous IDszma-miR395b*
Sequence

23 - 

guucccuacaagcacuucacaa

 - 44

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR395b-3p

Accession MIMAT0001698
Previous IDszma-miR395b
Sequence

75 - 

gugaaguguuugggggaacuc

 - 95

Get sequence
Deep sequencing171 reads, 130 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).