Stem-loop sequence zma-MIR394b

AccessionMI0001795 (change log)
DescriptionZea mays miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

8 open access papers mention zma-MIR394b
(16 sentences)

Stem-loop
   -u  c      u ag      -      u c           cuucuu     -ucuu       
5'   gg gcuuac g  aguucc uuggca u uguccaccucc      gacga     gcagaa 
     || |||||| |  |||||| |||||| | |||||||||||      |||||     ||||| a
3'   uc cggaug c  ucgagg aaccgu a acggguggagg      uuguu     cguuug 
   cc  -      - -g      u      c u           -uuugu     uuuuu       
Get sequence
Deep sequencing
2012 reads, 1.48e+03 reads per million, 183 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr4: 157728375-157728496 [+]
intergenic
Database links

Mature sequence zma-miR394b-5p

Accession MIMAT0001697
Previous IDszma-miR394b
Sequence

21 - 

uuggcauucuguccaccucc

 - 40

Get sequence
Deep sequencing1225 reads, 149 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence zma-miR394b-3p

Accession MIMAT0015163
Previous IDszma-miR394b*
Sequence

86 - 

aggugggcauacugccaaug

 - 105

Get sequence
Deep sequencing519 reads, 142 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).