Stem-loop sequence zma-MIR394a

AccessionMI0001794 (change log)
DescriptionZea mays miR394a stem-loop
Gene family MIPF0000100; MIR394
Literature search

8 open access papers mention zma-MIR394a
(16 sentences)

Stem-loop
   --  c      uga g      -      u c           ucucgccgaucuu      --a u 
5'   gg gcuuac   a aguucc uuggca u uguccaccucc             gcagaa   g u
     || ||||||   | |||||| |||||| | |||||||||||             ||||||   |  
3'   uc cggaug   u ucgagg aaccgu a acggguggagg             ugucuu   c u
   cc  -      --- g      u      c u           -uuuuuuuuacgu      gac a 
Get sequence
Deep sequencing
1639 reads, 1.09e+03 reads per million, 164 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 199240964-199241089 [+]
intergenic
Database links

Mature sequence zma-miR394a-5p

Accession MIMAT0001696
Previous IDszma-miR394a
Sequence

21 - 

uuggcauucuguccaccucc

 - 40

Get sequence
Deep sequencing841 reads, 130 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR394a-3p

Accession MIMAT0015162
Previous IDszma-miR394a*
Sequence

90 - 

aggugggcauacugccaaug

 - 109

Get sequence
Deep sequencing519 reads, 142 experiments
Evidence experimental; Illumina [2]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).