Stem-loop sequence zma-MIR171f

AccessionMI0001793 (change log)
DescriptionZea mays miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

21 open access papers mention zma-MIR171f
(58 sentences)

Stem-loop
   uugguuguu    -     -ag  c                     -------   -    g  cgcggguggcuuauagcuua 
5'          ggcu gagag   ug gauguuggcauggcucaauca       acu cgcc gc                    a
            |||| |||||   || |||||||||||||||||||||       ||| |||| ||                     
3'          ccga cucuu   ac cuauaaccgugccgaguuagu       uga gcgg cg                    u
   -----auau    u     cca  a                     uaauuug   c    g  uggagcuagcuuacgcgucu 
Get sequence
Deep sequencing
3782 reads, 2e+03 reads per million, 192 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 8896283-8896437 [-]
intergenic
Database links

Mature sequence zma-miR171f-5p

Accession MIMAT0015161
Previous IDszma-miR171f*
Sequence

23 - 

cgauguuggcauggcucaauc

 - 43

Get sequence
Deep sequencing28 reads, 13 experiments
Evidence experimental; Illumina [3]

Mature sequence zma-miR171f-3p

Accession MIMAT0001695
Previous IDszma-miR171f
Sequence

118 - 

uugagccgugccaauaucaca

 - 138

Get sequence
Deep sequencing2179 reads, 175 experiments
Evidence experimental; Illumina [3]

References

1
PMID:15916721 "Identification and characterization of new plant microRNAs using EST analysis" Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA Cell Res. 15:336-360(2005).
2
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
3
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).