Stem-loop sequence zma-MIR171d

AccessionMI0001792 (change log)
DescriptionZea mays miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

19 open access papers mention zma-MIR171d
(51 sentences)

Stem-loop
   agaa       u   a  au         u       c       uugaa    ----aau  a 
5'     auggaag gua cu  gguguuggc cggcuca ucagaag     gccg       cc a
       ||||||| ||| ||  ||||||||| ||||||| |||||||     ||||       ||  
3'     uacuuuc cau ga  cuauaaccg gccgagu agucuuu     cggc       gg a
   gucg       u   -  cu         u       u       ----g    cgucgau  u 
Get sequence
Deep sequencing
5312 reads, 2.81e+03 reads per million, 190 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr9: 128212960-128213080 [+]
intergenic
Database links

Mature sequence zma-miR171d-5p

Accession MIMAT0015160
Previous IDszma-miR171d*
Sequence

23 - 

uguuggcucggcucacucaga

 - 43

Get sequence
Deep sequencing516 reads, 149 experiments
Evidence experimental; Illumina [2]

Mature sequence zma-miR171d-3p

Accession MIMAT0001694
Previous IDszma-miR171d
Sequence

82 - 

ugauugagccgugccaauauc

 - 102

Get sequence
Deep sequencing2873 reads, 172 experiments
Evidence experimental; Illumina [2]
Database links

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).