Stem-loop sequence gma-MIR169a

AccessionMI0001791 (change log)
Previous IDsgma-MIR169
DescriptionGlycine max miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

26 open access papers mention gma-MIR169a
(104 sentences)

Stem-loop
   a            agu   gc       g ug           uuauu   --  cu   g 
5'  agaggaagagag   gau  agccaag a  acuugccggcg     auu  ug  cau u
    ||||||||||||   |||  ||||||| |  |||||||||||     |||  ||  |||  
3'  ucuucuucucuc   uug  ucgguuu u  ugaacggccgu     ugg  ac  gua u
   -            guu   ua       g gu           uccuu   cc  uc   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 38336014-38336134 [+]
intergenic
Database links

Mature sequence gma-miR169a

Accession MIMAT0001693
Previous IDsgma-miR169
Sequence

21 - 

cagccaaggaugacuugccgg

 - 41

Get sequence
Evidence experimental; 454 [1,3], Northern [1]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).