Stem-loop sequence gma-MIR396b

AccessionMI0001786 (change log)
DescriptionGlycine max miR396b stem-loop
Gene family MIPF0000047; MIR396
Literature search

27 open access papers mention gma-MIR396b
(169 sentences)

Stem-loop
   cuca  u    ----      c                   a     uau  aucuuau   u  cca 
5'     ag ccug    gucaug uuuuccacagcuuucuuga cuucu   gc       auc cu   c
       || ||||    |||||| ||||||||||||||||||| |||||   ||       ||| ||    
3'     uc ggac    cgguau agagggugucgaaagaacu gaaga   cg       uag ga   c
   ----  -    uuaa      a                   c     ucc  --aauuu   -  ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 27517027-27517152 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR396b
gma-MIR396bchr13: 27517027-27517152 [+]
gma-MIR396achr13: 27525230-27525369 [-]
Database links

Mature sequence gma-miR396b-5p

Accession MIMAT0001688
Previous IDsgma-miR396b
Sequence

21 - 

uuccacagcuuucuugaacuu

 - 41

Get sequence
Evidence experimental; 454 [1], Illumina [3]

Mature sequence gma-miR396b-3p

Accession MIMAT0020923
Sequence

89 - 

gcucaagaaagcugugggaga

 - 109

Get sequence
Evidence experimental; Illumina [3-4]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).