Stem-loop sequence gma-MIR396a

AccessionMI0001785 (change log)
DescriptionGlycine max miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

26 open access papers mention gma-MIR396a
(214 sentences)

Stem-loop
   uca       c       uc            c          uccaaagaguuccuuugcaugcaugc 
5'    uggcucu uuuguau  uuccacagcuuu uugaacugca                          c
      ||||||| |||||||  |||||||||||| ||||||||||                          a
3'    acuggga agacaua  agggugucgaaa aacuuggcgu                          u
   -ca       u       ga            u          uuuguucuaaacccucauucucacgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 27525230-27525369 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR396a
gma-MIR396achr13: 27525230-27525369 [-]
gma-MIR396bchr13: 27517027-27517152 [+]
Database links

Mature sequence gma-miR396a-5p

Accession MIMAT0001687
Previous IDsgma-miR396a
Sequence

21 - 

uuccacagcuuucuugaacug

 - 41

Get sequence
Evidence experimental; 454 [1], Northern [1], Illumina [3]

Mature sequence gma-miR396a-3p

Accession MIMAT0020922
Sequence

104 - 

uucaauaaagcugugggaag

 - 123

Get sequence
Evidence experimental; Illumina [3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).