Stem-loop sequence gma-MIR156a

AccessionMI0001784 (change log)
DescriptionGlycine max miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

41 open access papers mention gma-MIR156a
(176 sentences)

Stem-loop
   -cacacc   u  a a            -     -        au   agug   u       a 
5'        aga ug g gaggcugacaga agaga gugagcac  gcu    gua uuguaug g
          ||| || | |||||||||||| ||||| ||||||||  |||    ||| |||||||  
3'        ucu ac c cuucgacugucu ucucu cacucgug  ugg    cgu aacauac g
   cauuuuu   u  - -            a     u        cg   ---g   u       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 5885507-5885628 [-]
intergenic
Database links

Mature sequence gma-miR156a

Accession MIMAT0001686
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Evidence experimental; 454 [1,3]

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).
2
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).